Fecha añadida
04 jun. 2024
a las 11:24 PM UTC
Fecha añadida
24 oct. 2023
a las 12:39 AM UTC
Fecha añadida
14 oct. 2023
a las 01:40 AM UTC
Descripción
Mild earthy smell and taste.
Collected
Fecha añadida
21 oct. 2023
a las 02:16 AM UTC
Descripción
Growing under a big red alder log.
Very delicate.
Mild smell and taste.
Fecha añadida
12 oct. 2023
a las 06:46 PM UTC
Fecha añadida
15 oct. 2023
a las 07:53 PM UTC
Fecha añadida
30 may. 2024
a las 01:23 PM MDT
Descripción
Amazing purple spores. Native prairie southern Alberta
Fecha añadida
30 may. 2024
a las 04:07 AM UTC
Fecha añadida
27 may. 2024
a las 08:58 PM EDT
Descripción
On large rotting sugar maple stump. Huge! 30 cm wide.
Fecha añadida
24 may. 2024
a las 05:04 AM UTC
Fecha añadida
22 may. 2024
a las 09:27 AM MDT
Descripción
Growing from incubated moose dung
Fecha añadida
18 may. 2024
a las 06:47 PM PDT
Fecha añadida
16 may. 2024
a las 12:28 AM UTC
Fecha añadida
13 may. 2024
a las 11:07 PM CST
Descripción
Didn’t have anything for precise measurements. Used a dime to highlight relative size.
Fecha añadida
11 may. 2024
a las 10:53 PM UTC
Fecha añadida
16 abr. 2024
a las 08:42 PM UTC
Descripción
DNA sequence recorded.
Specimens stored in Alberta Mycological Fungarium
Found garden soil while digging up potatoes. Nearby trees include crabapple, aspens and spruce.
GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATATCTGGGATGCCAAAGACACAGGCTCCCGATAAAACACATTTATGCGTATCCTTCCATGTTGCTTTCCCAGGCCAGTGGCCACTGCTGCCAGCCATGCCGCTTTTCGGTTACATGGTTGAGGTGCTTGGGGAAGGGCTAATTATCAAACTTTACTTCACCTTATTGTCTGAGAAGGCCATGTGCCGTAATCTTTAAACATGTTAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCGCAAAAACCCAGATCACCTAGAGTGTGGTATTGGCAGAAGTGGCCGGGGCTATCAGCGCTGCTGCCACTCTGCTGGAATGAATAGGCTGGAAAAGTAGATCATAGCAACAGACTTTCACAGTATTTTGAAATGCTAAATTAGTTTGAAGCTGATCGGAACCTAAGCCATTTGACCCCCATCCTGCGTAAAGCAGTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC
Fecha añadida
01 may. 2024
a las 10:37 PM UTC
Fecha añadida
31 may. 2022
a las 02:26 AM UTC
Fecha añadida
01 may. 2024
a las 09:56 AM PDT
Fecha añadida
09 abr. 2024
a las 10:48 AM EDT
Descripción
Spores: 11.97-15.01 x 4.32-5.14, Q = 2.66-3.00 (mean = 13.29 x 4.65, Qe = 2.86), n = 8.
Fecha añadida
31 mar. 2024
a las 11:06 AM UTC
Descripción
Growing on a yellow/swamp birch (Betula alleghaniensis) branch used as a stake in the garden.
Fecha añadida
29 mar. 2024
a las 06:53 PM PDT
Fecha añadida
10 jun. 2023
a las 11:00 AM PDT
Fecha añadida
20 jun. 2023
a las 11:11 PM UTC
Fecha añadida
28 jul. 2023
a las 01:05 AM UTC
Fecha añadida
17 nov. 2023
a las 03:05 PM MST
Fecha añadida
30 jul. 2023
a las 11:37 PM MDT
Fecha añadida
20 ago. 2023
a las 09:02 PM MDT
Fecha añadida
17 mar. 2024
a las 11:35 AM ADT
Descripción
On forest floor/litter under mature hemlock in an old-growth Eastern hemlock stand.
Basidiospores (3.8) 4.3 - 5.4 (6.3) × (2.0) 2.1 - 2.66 (2.7) µm
Q = (1.6) 1.8 - 2.3 (2.6) ; N = 25
Me = 4.9 × 2.4 µm ; Qe = 2.1
Fecha añadida
14 mar. 2024
a las 02:53 AM UTC
Descripción
Sitka spruce, fir, redwood, alder, bay laurel growing in the area.
Fruiting abundantly under redwood trees next to Russ park pond.
Fecha añadida
12 mar. 2024
a las 11:23 AM HST
Fecha añadida
01 mar. 2024
a las 05:40 PM HST
Fecha añadida
27 feb. 2024
a las 07:54 AM PST
Fecha añadida
25 feb. 2024
a las 10:58 PM PST
Fecha añadida
26 feb. 2024
a las 10:23 AM HST
Lugar
Privado
Fecha añadida
26 sep. 2023
a las 05:38 PM UTC
Fecha añadida
24 feb. 2024
a las 05:16 PM UTC
Fecha añadida
24 feb. 2024
a las 06:20 PM UTC
Fecha añadida
23 feb. 2024
a las 05:20 PM PST
Fecha añadida
15 jul. 2023
a las 09:12 PM MDT
Fecha añadida
12 sep. 2023
a las 10:47 AM MDT
Fecha añadida
30 jul. 2020
a las 06:08 PM UTC
Fecha añadida
08 oct. 2023
a las 09:15 PM UTC
Fecha añadida
23 dic. 2023
a las 05:38 PM PST
Descripción
Amazing textures and algae integration (?) with maze like elongated pore surface distinct from T. Versicolor
Fecha añadida
23 oct. 2021
a las 08:22 PM PDT
Fecha añadida
11 ago. 2023
a las 10:35 PM UTC
Descripción
Growing in the moss.
Spermatic smell and mild taste.
7091
Fecha añadida
11 ago. 2023
a las 10:42 PM UTC
Descripción
Slimy.
Growing in the moss.
7093
Fecha añadida
10 ago. 2023
a las 02:01 AM UTC
Descripción
Strong odor I can't place.
7106
Fecha añadida
11 ago. 2023
a las 09:52 PM UTC
Descripción
Growing in the moss.
Sweet earthy smell and taste.
7082
Fecha añadida
11 ago. 2023
a las 09:54 PM UTC
Descripción
Growing in the moss and forest duff.
Sweet earthy smell and taste.
7083
Fecha añadida
11 ago. 2023
a las 10:01 PM UTC
Descripción
Growing in the moss.
Sweet earthy smell and taste.
Looks Amanita, but no vulva/cup.
Infected Russula (Hypomyces?)
7084
Fecha añadida
11 ago. 2023
a las 10:52 PM UTC
Descripción
Growing in the forest duff.
7094
Fecha añadida
11 ago. 2023
a las 10:09 PM UTC
Descripción
Growing in the forest duff and weeds.
Mild smell and slight watermelon rind taste.
7087
Fecha añadida
11 ago. 2023
a las 10:24 PM UTC
Descripción
Growing in the moss.
Mild smell and taste.
7089
Fecha añadida
11 ago. 2023
a las 10:15 PM UTC
Descripción
Growing in the moss and forest duff.
Sweet earthy smell and taste.
7088
Fecha añadida
11 sep. 2022
a las 08:58 PM MDT
Fecha añadida
14 sep. 2022
a las 09:49 AM MDT
Descripción
Growing with Populus tremuloides.
Fecha añadida
14 sep. 2022
a las 09:57 AM MDT
Descripción
Growing with Populus tremuloides.
Fecha añadida
31 ago. 2023
a las 04:43 AM UTC
Fecha añadida
03 sep. 2023
a las 05:29 AM UTC