Fotos / Sonidos

Qué

Orangután de Borneo Nororiental (Pongo pygmaeus ssp. morio)

Autor

mmike78

Fecha

Mayo 2024

Lugar

Sabah, MY (Google, OSM)

Fotos / Sonidos

Qué

Armadillo de Nueve Bandas (Dasypus novemcinctus)

Fecha

Abril 10, 2024 a las 09:41 AM CDT

Fotos / Sonidos

Autor

smithsqrd

Fecha

Abril 2024

Lugar

Falta ubicación

Fotos / Sonidos

Qué

Carpintero de Cresta (Dryocopus pileatus)

Autor

tozjohn

Fecha

Enero 20, 2024

Fotos / Sonidos

Autor

andie_ang

Fecha

Marzo 5, 2024 a las 06:22 PM +08

Fotos / Sonidos

Qué

Orangután de Borneo Nororiental (Pongo pygmaeus ssp. morio)

Autor

andie_ang

Fecha

Marzo 2024

Fotos / Sonidos

Qué

Chara Yucateca (Cyanocorax yucatanicus)

Autor

kkruljac

Fecha

Febrero 19, 2024 a las 09:20 AM EST

Fotos / Sonidos

Qué

Zorro Rojo (Vulpes vulpes)

Autor

dhcox57

Fecha

Enero 15, 2015 a las 07:25 AM EST

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

kalyanvarma

Fecha

Junio 27, 2008 a las 12:09 AM IST

Fotos / Sonidos

Autor

gbrunvoll

Fecha

Diciembre 2017

Lugar

Uganda (Google, OSM)

Descripción

Chimpanzee, Kibale NP Uganda

Fotos / Sonidos

Autor

likes2hike

Lugar

Uganda (Google, OSM)

Fotos / Sonidos

Qué

Orangután de Borneo Nororiental (Pongo pygmaeus ssp. morio)

Autor

gaell

Fecha

Agosto 2018

Lugar

Sabah, MY (Google, OSM)

Etiquetas

Fotos / Sonidos

Qué

Orangután de Borneo (Pongo pygmaeus)

Autor

bottin

Fecha

Agosto 2007

Lugar

Sabah, MY (Google, OSM)

Descripción

KONICA MINOLTA DIGITAL CAMERA

Fotos / Sonidos

Autor

dave_k_h

Fecha

Diciembre 2017

Lugar

Guatemala (Google, OSM)

Fotos / Sonidos

Fecha

Mayo 2021

Lugar

Uganda (Google, OSM)

Fotos / Sonidos

Qué

Hongos Nido de Pájaro (Familia Nidulariaceae)

Autor

johnplischke

Fecha

Agosto 8, 2022 a las 10:30 AM EDT

Fotos / Sonidos

Qué

Mariposa Pavoreal Blanca (Anartia jatrophae)

Autor

dandkforever

Fecha

Junio 29, 2022 a las 05:19 PM EDT

Fotos / Sonidos

Fecha

Junio 2022

Descripción

Found this on lower branch of wild tree. Night macro walk.

Fotos / Sonidos

Autor

ana_kaahanui

Fecha

Abril 30, 2022 a las 12:35 PM EDT

Fotos / Sonidos

Autor

bugzilla

Fecha

Agosto 28, 2021 a las 07:51 AM EDT

Descripción

One of dozens of webs glistening in the morning dew.

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Fecha

Febrero 15, 2022 a las 09:27 PM UTC

Descripción

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Fecha

Febrero 15, 2022 a las 08:27 PM UTC

Descripción

taken during travels to Sri Lanka in 2022 - taken by Thomas Fuhrmann, SnowmanStudios - see more pictures on www.snowmanstudios.de

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

anoopnair747

Fecha

Marzo 2021

Lugar

Kerala, IN (Google, OSM)

Descripción

Rescued this beautiful creature from a owl and released in a suitable habitat

Fotos / Sonidos

Qué

Orangután de Borneo (Pongo pygmaeus)

Autor

michal243

Fecha

Abril 2013

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

aravindmanoj

Fecha

Enero 22, 2022

Lugar

Dindigul (Google, OSM)

Fotos / Sonidos

Qué

Orangután de Borneo (Pongo pygmaeus)

Autor

michal243

Fotos / Sonidos

Qué

Búho Nival (Bubo scandiacus)

Autor

mattyfelp

Fecha

Enero 6, 2022 a las 09:58 PM EST

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

murugeshgeo

Fecha

Agosto 2021

Fotos / Sonidos

Qué

Orangután de Borneo (Pongo pygmaeus)

Autor

budak

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Fecha

Mayo 28, 2011 a las 04:57 PM IST

Descripción

Observer: Sanjeev Kumar

Fotos / Sonidos

Autor

valehu

Fecha

Mayo 2021

Fotos / Sonidos

Qué

Chalchuanes (Género Erigeron)

Autor

rundvm1

Fecha

Abril 30, 2021 a las 11:08 AM EDT

Fotos / Sonidos

Qué

Junco Ojos Negros (Junco hyemalis)

Fecha

Febrero 21, 2021 a las 01:40 PM EST

Fotos / Sonidos

Qué

Orangután de Borneo Nororiental (Pongo pygmaeus ssp. morio)

Autor

alphaj16

Fecha

Agosto 2018

Fotos / Sonidos

Autor

maryeford

Fecha

Octubre 2, 2014 a las 02:15 PM EDT

Fotos / Sonidos

Autor

maryeford

Fecha

Octubre 12, 2015 a las 03:24 PM EDT

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

danielraju

Fecha

Marzo 15, 2017

Fotos / Sonidos

Qué

Loris Esbelto Gris (Loris lydekkerianus)

Autor

ron1th

Fecha

Junio 25, 2020 a las 08:30 AM IST

Descripción

Found a pair of Grey Slender Loris hiding in the thick canopy of a tree, got decent views

Fotos / Sonidos

Qué

Orangután de Borneo (Pongo pygmaeus)

Autor

gery-dupas

Fecha

Noviembre 2015

Fotos / Sonidos

Fecha

Mayo 2020

Descripción

Well, this is one of the stranger wildlife interactions I’ve had in my yard. I’m sitting out here working with my laptop and a bag of M&Ms and this butterfly flies towards me and goes straight for the bag. I stare in disbelief as it climbs in, fumble for my phone, and snap a few shots before it climbs out and flies away.

Fotos / Sonidos

Qué

Abejorro Carpintero Europeo (Xylocopa violacea)

Fecha

Agosto 19, 2016 a las 02:22 PM CEST

Fotos / Sonidos

Qué

Salamandra Limosa de Manchas Blancas (Plethodon cylindraceus)

Autor

graytreefrog

Fecha

Abril 2020

Descripción

First record of this species in Arlington County since 1977. Adult female found under a log in an upland area dominated by mountain laurel, similar to the habitat I’ve found this species in elsewhere in northern Virginia. This was in a park that has been extensively surveyed, yet there aren’t even any historical records of this species from this park. Absolutely amazing to find this species somewhere it has gone undetected for all this time.

Fotos / Sonidos

Qué

Venado de Cola Blanca (Odocoileus virginianus)

Autor

jamesdunbar

Fecha

Mayo 15, 2019 a las 09:23 AM UTC

Fotos / Sonidos

Qué

Carpintero de Vientre Rojo (Melanerpes carolinus)

Fecha

Septiembre 19, 2019 a las 08:31 AM EDT

Fotos / Sonidos

Qué

Ardillón de California (Otospermophilus beecheyi)

Fecha

Agosto 9, 2010 a las 08:46 AM EDT

Fotos / Sonidos

Qué

Milano Cola Blanca (Elanus leucurus)

Fecha

Agosto 9, 2010 a las 05:45 PM EDT

Fotos / Sonidos

Qué

Lobo Marino Californiano (Zalophus californianus)

Fecha

Enero 28, 2011 a las 02:51 PM EST

Fotos / Sonidos

Qué

Playero Rojo (Calidris canutus)

Fecha

Enero 28, 2011 a las 03:57 PM EST

Fotos / Sonidos

Qué

Gorrión Cola Blanca (Pooecetes gramineus)

Fecha

Septiembre 10, 2010 a las 08:13 AM EDT

Descripción

Vesper Sparrow - Pooecetes gramineus

Fotos / Sonidos

Qué

Pato Cola Larga (Clangula hyemalis)

Fecha

Enero 1, 2020 a las 10:22 AM EST

Descripción

Long-tailed Duck (male, non-breeding) - Clangula hyemalis

Fotos / Sonidos

Qué

Pato Chalcuán (Mareca americana)

Fecha

Enero 1, 2020 a las 12:12 PM EST

Descripción

American Wigeon Duck - Anas americana

Fotos / Sonidos

Qué

Gorrión Cantor (Melospiza melodia)

Fecha

Septiembre 29, 2019 a las 07:52 AM EDT

Fotos / Sonidos

Qué

Zumbador de Allen (Selasphorus sasin)

Fecha

Noviembre 3, 2019 a las 11:39 AM EST

Fotos / Sonidos

Fecha

Diciembre 3, 2019 a las 02:12 PM EST

Descripción

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Fotos / Sonidos

Fecha

Diciembre 3, 2019 a las 02:12 PM EST

Descripción

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Fotos / Sonidos

Qué

Chorlo Gris (Pluvialis squatarola)

Fecha

Noviembre 2, 2019 a las 08:29 PM EDT

Descripción

Black-bellied Plover (non-breeding) - Pluvialis squatarola

Fotos / Sonidos

Qué

Chorlo Tildío (Charadrius vociferus)

Fecha

Noviembre 3, 2019 a las 02:14 PM EST

Fotos / Sonidos

Qué

Achichilique Pico Amarillo (Aechmophorus occidentalis)

Fecha

Noviembre 3, 2019 a las 11:12 AM EST

Fotos / Sonidos

Qué

Zambullidor Pico Grueso (Podilymbus podiceps)

Fecha

Noviembre 3, 2019 a las 11:07 AM EST

Fotos / Sonidos

Qué

Garza Nocturna Corona Negra (Nycticorax nycticorax)

Fecha

Noviembre 8, 2019 a las 11:06 AM EST

Fotos / Sonidos

Qué

Garza Nocturna Corona Negra (Nycticorax nycticorax)

Fecha

Noviembre 7, 2019 a las 08:41 PM EST

Lugar

Lindo Lake (Google, OSM)

Fotos / Sonidos

Qué

Garza Nocturna Corona Negra (Nycticorax nycticorax)

Fecha

Noviembre 7, 2019 a las 07:57 PM EST

Lugar

Lindo Lake (Google, OSM)

Fotos / Sonidos

Qué

Garza Nocturna Corona Negra (Nycticorax nycticorax)

Fecha

Noviembre 3, 2019 a las 11:23 AM EST

Fotos / Sonidos

Qué

Besuconas (Género Hemidactylus)

Autor

aphaywood

Fecha

Noviembre 18, 2019 a las 11:35 AM IST

Fotos / Sonidos

Qué

Garza Morena (Ardea herodias)

Fecha

Noviembre 2, 2019 a las 07:38 PM EDT

Fotos / Sonidos

Qué

Garza Rojiza (Egretta rufescens)

Fecha

Noviembre 8, 2019 a las 11:58 AM EST

Fotos / Sonidos

Qué

Insecto Palo Norteño (Diapheromera femorata)

Fecha

Agosto 27, 2019 a las 05:01 AM EDT

Fotos / Sonidos

Qué

Tirano Dorso Negro (Tyrannus tyrannus)

Fecha

Julio 26, 2019 a las 08:33 AM EDT

Descripción

Eastern Kingbird [Flycatcher] - Tyrannus tyrannus

Fotos / Sonidos

Qué

Garcita Verde (Butorides virescens)

Fecha

Julio 26, 2019 a las 08:30 AM EDT

Fotos / Sonidos

Qué

Garcita Verde (Butorides virescens)

Fecha

Julio 26, 2019 a las 09:57 AM EDT

Descripción

Green Heron - Butorides virescens

Fotos / Sonidos

Qué

Tordo Sargento (Agelaius phoeniceus)

Fecha

Julio 26, 2019 a las 08:16 AM EDT

Fotos / Sonidos

Qué

Babosa Tigre (Limax maximus)

Fecha

Julio 3, 2019 a las 05:03 AM EDT

Fotos / Sonidos

Qué

Golondrina Bicolor (Tachycineta bicolor)

Fecha

Abril 21, 2019 a las 09:46 AM EDT

Fotos / Sonidos

Qué

Rascador Moteado (Pipilo erythrophthalmus)

Fecha

Junio 27, 2019 a las 04:26 PM EDT

Fotos / Sonidos

Qué

Azulejo Garganta Canela (Sialia sialis)

Fecha

Mayo 24, 2019 a las 09:45 AM EDT

Descripción

Eastern Bluebird (female) - Sialia sialis

Fotos / Sonidos

Qué

Azulejo Garganta Canela (Sialia sialis)

Fecha

Mayo 24, 2019 a las 09:15 AM EDT

Descripción

Eastern Bluebird (male) - Sialia sialis

Fotos / Sonidos

Qué

Charrán Común (Sterna hirundo)

Fecha

Junio 18, 2019 a las 12:05 PM EDT

Descripción

Catching a fish

Fotos / Sonidos

Qué

Tortuga Lagarto Norteña (Chelydra serpentina)

Fecha

Mayo 24, 2019 a las 08:27 AM EDT

Etiquetas

Fotos / Sonidos

Qué

Leopardo Africano (Panthera pardus ssp. pardus)

Autor

evan81

Fecha

Abril 2019

Fotos / Sonidos

Qué

Milano Tijereta (Elanoides forficatus)

Fecha

Abril 29, 2019 a las 06:34 PM EDT

Descripción

Heard the kite smack into a tree branch and didn't realize what it was doing until it dropped this guy from above!

Fotos / Sonidos

Qué

Garza Morena (Ardea herodias)

Fecha

Abril 21, 2019 a las 09:01 AM EDT

Fotos / Sonidos

Qué

Chipe Suelero (Seiurus aurocapilla)

Fecha

Abril 21, 2019 a las 10:27 AM EDT

Fotos / Sonidos

Qué

Tordo Cabeza Café (Molothrus ater)

Fecha

Abril 21, 2019 a las 08:13 AM EDT

Fotos / Sonidos

Qué

Golondrina Bicolor (Tachycineta bicolor)

Fecha

Marzo 31, 2019 a las 06:26 PM EDT

Fotos / Sonidos

Qué

Colimbo Común (Gavia immer)

Fecha

Marzo 31, 2019 a las 07:01 PM EDT

Fotos / Sonidos

Qué

Ganso Canadiense Mayor (Branta canadensis)

Fecha

Marzo 31, 2019 a las 06:46 PM EDT

Fotos / Sonidos

Qué

Tortuga Gravada (Trachemys scripta)

Fecha

Abril 1, 2019 a las 05:23 PM EDT

Fotos / Sonidos

Fecha

Abril 3, 2019 a las 05:36 PM EDT

Fotos / Sonidos

Qué

Anhinga Americana (Anhinga anhinga)

Fecha

Marzo 29, 2019 a las 05:21 PM EDT

Fotos / Sonidos

Qué

Pato Arcoíris (Aix sponsa)

Fecha

Marzo 1, 2019 a las 08:59 PM EST

Fotos / Sonidos

Qué

Garza Dedos Dorados (Egretta thula)

Fecha

Febrero 25, 2019 a las 09:29 PM EST

Etiquetas

Fotos / Sonidos

Qué

Garza Nocturna Corona Negra (Nycticorax nycticorax)

Fecha

Febrero 25, 2019 a las 09:12 PM EST

Descripción

Black-crowned Night-Heron - Nycticorax nycticorax

Fotos / Sonidos

Qué

Gallineta Morada (Porphyrio martinica)

Autor

tomdriscoll

Fecha

Febrero 14, 2019 a las 10:40 AM EST

Fotos / Sonidos

Autor

rhjackso

Fecha

Febrero 28, 2019 a las 03:24 PM PST

Fotos / Sonidos

Qué

Costurero Pico Corto (Limnodromus griseus)

Fecha

Mayo 10, 2015 a las 02:25 PM EDT

Fotos / Sonidos

Qué

Calandria Flancos Negros (Icterus abeillei)

Fecha

Enero 4, 2019

Lugar

Tlalpan (Google, OSM)

Descripción

Macho.

Fotos / Sonidos

Qué

Chipe Rabadilla Amarilla (Setophaga coronata)

Autor

uzun

Fecha

Enero 4, 2019 a las 09:25 AM PST

Fotos / Sonidos

Qué

Chipe Rabadilla Amarilla (Setophaga coronata)

Autor

mattk561

Fecha

Diciembre 13, 2018 a las 09:06 AM PST

Descripción

Bobelaine Sanctuary