from collection Museum Joanneum Graz without locality label but probably from the department of Styria
Two found under a small rock. Operating under a scientific collecting permit.
Swept from vegetation, 18 mm, also posted to BG here:
https://bugguide.net/node/view/1654401
Best find of the year!!!!!!!!! First ever Ripiphorid for me
Found on Mossy decaying conifer amongst tall grass near stream. Couldn't get a solid spore print. 9400ft.
I'm a noob so please correct me if the ID is incorrect.
Photo license and credit belong to the Florida Museum of Natural History (FLMNH), the Hakai Institute, and MarineGEO | http://specifyportal.flmnh.ufl.edu/iz/ | Field Number: BHAK-2265 | This observation is a part of the collaborative work between FLMNH, the Smithsonian Institution's Marine Global Earth Observatory (MarineGEO) and Tennenbaum Marine Observatories Network, the Smithsonian's National Museum of Natural History, and the Hakai Institute
near the Bancroft Laboratory, White Mountain Research Station (University of California), elevation about 3600 meters.
Spores 45-53 X 6-7 µm.
Some sort of Myxobacteria, maybe?
From a moist chamber. The substrate for the moist chamber was collected on 08-19-23, and the fruiting body was observed on 11-13-23.
The substrate was some mostly oak leaf litter and other detritus from the forest floor here.
The body in silhouette in the first photo is around 50 microns in diameter.
Voucher Collection 9537 was collected on 22 November 2008 in an Oak/Douglas-fir Forest west of Salyer, Trinity County, California. The 2 fruiting bodies were caespitose in humus beneath an Oak. Sarah Burgeman obtained ITS sequence and Sharon Squazzo analyzed this sequence and indicated it was a 100% match to iNat 14804387. Sarah Bergeman also obtained unpublished sequences for gene RPB2, nLSU and mtSSU
On moss (Pseudotaxiphyllum elegans). Ran out of time to do more microscopy. Spores and asci are small- spores measured around 5x2 microns
Just amazing! Parasitizing Ten-lined June beetle (Polyphylla decemlineata) on an open slope of sand. Insitu, already exposed when found
In soil near burned cottonwoods.
Exciple smooth, whitish; epihymenium pruplish, subhymenium white.
Asci 267–287 x 12.5–15 µm; IKI+ amyloid with distinct ring, and weak reaction on wall, only intense at top. Ascus base like fish tail fin.
Paraphyses simple, cylindrical, 3.3 µm thick, equal; clavate end 4.3 µm thick, not crooked.
Subhymenium textura prismatica.
Ascospores hyaline smooth, biguttulate, [13.6] 14–15.5 [16.8] x [7.5] 8.2–9 [9.5] µm (mean 14.7 x 8.7 µm); Q 1.4–1.8 (mean 1.7); larger than G. violacea s. str. (“12,5-14 (-14,5) × 7,8-8,5 μm”).
Van Vooren N., Dougoud R., Moyne G., Vega M., Carbone M., Perić B. Vol. 13 (5) – 29 September 2021
Tour d’horizon des pézizes violettes (Pezizaceae) présentes en Europe. 3e partie : le genre Geoscypha
Found under Ganoderma.
@Warren_Cardimona collected the sample for sequencing.
Good discussion of this genus at https://www.mycoguide.com/guide/fungi/asco/sord/hypo/hypo/spor
two grown up young owls perched on a branch of conifer in front yard of a house with coniferous, deciduous, and palm trees.
Vocalizing.
A fountain is in the front yard.
F000310
Found in a CHEG zone along the banks of a very tiny stream. All four CHEG families were present within ~10ft.
Last photo has a scale bar that is calibrated at the depth of the numbered tag. That photo has been color edited so that the fruiting bodies can be better seen.
Auweia collection.
[admin – Sat Aug 14 02:05:14 +0000 2010]: Changed location name from ‘Richmond, CA, USA’ to ‘Richmond, California, USA’
—
Image #4: Microscopy composite by Workman
—
Originally posted to Mushroom Observer on Feb. 19, 2009.
F000250
Paraphyses brown, curved at tips.
Asci tips blue in Melzers (all micrographs are Melzers mounts)
spores ~20µm
Willing to do measurements but I don't believe its necessary at this time. Scale bars are accurate.
on volcanic rock in a recent burn on exposed slope. second image with 10% KOH
Growing in wood chip landscaping.
The caps with an undulate margin are atypical.
Hunting with Lee Walstad at the holotype location.
Apple Drump collection.
ITS sequence:
TCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTGTCATTATGTGCTGTCCGAATGAACGGACGGTTAGAAGCAGCTTTTAA
AACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTT
AAGGGGAGCTGACTTCAAATGAAGCCGGCAAAAGACCCCCAAATCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTG
AGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGA
ATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTA
TATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGACCGCTTGAGAAAAAG
ACCTTCAACTCTGGGAGGGCCGTGAAGCTTCCCCCATCCTATCCAGTCTTCTTTCAAACGTCTACAAAAGGTTCACAGGTGGA
GATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGA
Spore measurements:
9.7 [10.7 ; 11.1] 12.1 × 5.6 [6.4 ; 6.8] 7.5 µm
Q = 1.4 [1.6 ; 1.7] 1.9 ; N = 30 ; C = 95%
Me = 10.9 × 6.6 µm ; Qe = 1.7
9.81 5.64
10.28 7.02
10.20 6.35
10.19 6.30
11.10 6.90
11.14 6.60
11.55 6.79
10.72 6.24
10.94 6.64
10.46 7.55
10.15 6.90
11.43 5.65
10.97 6.11
11.63 7.11
10.96 7.03
11.02 6.18
12.58 7.22
10.83 6.46
11.06 6.48
11.71 7.00
11.58 7.43
10.45 6.16
10.85 6.23
10.33 6.28
11.86 6.97
11.00 6.69
10.67 6.41
10.21 6.81
10.89 6.35
10.68 5.93
On turkey vulture wing.
Fruiting in small groups not clustered.
Stipe absent.
Interior cup covered in fine black hairs.
Exterior cup smooth.
Margin scurfy, ragged, darker.
Spores surrounded by gelatinous wrinkled ribbed sheath.
Spores in groups of 8 in asci.
Spores purple brown.
Magnification 1000x in Melzer’s.
hundreds(?) of mostly mature fruits in multiple areas in a landscaped mulch bed with apparent drip irrigation
collected by Matthew Koons
Site accessed with DNR permission
Came into the Northwest Mushroomers Association fungus fair in Bellingham.
Growing in a grassy field.
From the same spot as https://www.ncbi.nlm.nih.gov/nuccore/KC669295
First photo in 365 nanometer ultraviolet light
Taste like radish and cucumber. Mildly staining blue where damaged. In a muddy hillside near a stream.
Cap turning reddish in KOH.